circad | circRNAs associated with diseases

hsa_circ_0032821
Gene	CEP128	Organism	Human
Genome Locus	chr14:81209418-81227957:-	Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	28737829
Experimental Method
Sample Type	Tissues	Comparison	Three sets of primary Gastric Cancer (GC) tissue samples (the GC group) and paired, adjacent noncancerous tissues
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AGATAGAAAGGCAGGAGCAG Reverse TGTTCAGTCTCCAAGCAAAG	Statistics	Fold Change : Upregulated,5.91 pvalue : p=0.048
Citation
Huang, YS, Jie, N, Zou, KJ, Weng, Y (2017). Expression profile of circular RNAs in human gastric cancer tissues. Mol Med Rep, 16, 3:2469-2476.